Announcements
Eurosurveillance remains in the updated list of the Directory of Open Access Journals (DOAJ). It was first added to the DOAJ on 9 September 2004. Eurosurveillance is also listed in the Securing a Hybrid Environment for Research Preservation and Access / Rights MEtadata for Open archiving (SHERPA/RoMEO) [2], a database which uses a colour‐coding scheme to classify publishers according to their self‐archiving policy and to show the copyright and open access self-archiving policies of academic journals. Eurosurveillance is listed there as a ‘green’ journal, which means that authors can archive pre-print (i.e. pre-refereeing), post-print (i.e. final draft post-refereeing) and archive the publisher's version/PDF.

Follow Eurosurveillance on Twitter: @Eurosurveillanc

Read our articles on Zika virus infection

Note of concern published for 'Epidemiological investigation of MERS-CoV spread in a single hospital in South Korea, May to June 2015', http://bit.ly/29QFXPp


In this issue


Home Eurosurveillance Edition  2017: Volume 22/ Issue 1 Article 2
Back to Table of Contents
Previous Download (pdf)
Next

Eurosurveillance, Volume 22, Issue 1, 05 January 2017
Research article
Naguib, Graaf, Fortin, Luttermann, Wernery, Amarin, Hussein, Sultan, Al Adhadh, Hassan, Beer, Monne, and Harder: Novel real-time PCR-based patho- and phylotyping of potentially zoonotic avian influenza A subtype H5 viruses at risk of incursion into Europe in 2017

+ Author affiliations


Citation style for this article: Naguib MM, Graaf A, Fortin A, Luttermann C, Wernery U, Amarin N, Hussein HA, Sultan H, Al Adhadh B, Hassan MK, Beer M, Monne I, Harder TC. Novel real-time PCR-based patho- and phylotyping of potentially zoonotic avian influenza A subtype H5 viruses at risk of incursion into Europe in 2017. Euro Surveill. 2017;22(1):pii=30435. DOI: http://dx.doi.org/10.2807/1560-7917.ES.2017.22.1.30435

Received:30 November 2016; Accepted:20 December 2016


Introduction

Influenza A viruses constitute a virus species in the family Orthomyxoviridae. They harbour single-stranded negative-sense RNA arranged into eight genomic segments. Members of this species which infect avian hosts (avian influenza viruses, AIV) are grouped into 16 (H1 to H16) and 9 (N1 to N9) subtypes, respectively, based on phylogenetic and antigenic properties of their haemagglutinin (HA) and neuraminidase (NA) envelope glycoproteins [1]. Different species of aquatic wild birds are the natural reservoirs for all AIV subtypes. Novel subtypes and gene constellations continue to evolve in aquatic wild birds or in infected poultry populations by genetic reassortment during infection of a single host cell with two or more distinct AIV genotypes. In addition to reassortment, the intrinsically error-prone influenza virus genome replication machinery promotes the generation of quasi-species that can be shaped by directional selection pressures, e.g. following host species switches or by specific herd immunity. In the latter case, antigenic drift variants are selected that may escape immunity by very few amino acid substitutions in the HA [2].

Based on their virulence in galliform poultry (e.g. chicken, turkey), AIV are distinguished into groups of highly pathogenic (HP) and low pathogenic (LP) phenotypes [3]. Correct AI diagnosis includes determining the HA subtype and, in case of subtypes H5 or H7, also the pathotype. So far, HPAI phenotypes detected in the field (i.e. ‘free’ natural environment), were only described among AIV of subtypes H5 and H7 [4]. Some of these viruses including those of the HPAI H5 goose/Guangdong (gs/GD) lineage that emerged in southern China in 1996, have zoonotic potential and are sporadically transmitted from infected birds to humans [5,6]. HPAI viruses of the gs/GD lineage have continued to circulate and evolved into numerous clades. Viruses of three major phylogenetic clades (2.2.1.2, 2.3.2.1 and 2.3.4.4) as well as of three further minor clades (1.1.2, 2.1.3.2 and 7.2) have become endemic in poultry populations in several countries in Asia, Africa and the Middle East [7]. Occasionally, spillover transmission from infected poultry may cause infection and viral spread in wild birds with increased mortality in some species. Infected migratory wild birds may spread such viruses across wider distances and act as the source of transmission back to poultry [7,8].

Europe has experienced several incursions by viruses of the gs/GD lineage over the past decade; both wild birds and poultry were affected but no human cases were reported [9]. This is in sharp contrast to Egypt and Asian countries where the endemicity of HPAI H5 viruses in poultry is associated with repeated spillover transmission to and infection of humans. In fact, the majority of human HPAI H5 cases worldwide were registered in Egypt [10,11]. Moreover, a new major clade, designated 2.2.1.2, evolved along with transient spread of an escape mutant-based lineage, 2.2.1.1, in this country [12].

Further potentially zoonotic gs/GD viruses of clade 2.3.2.1c are widespread in Central and Southern Asia and they were sporadically detected along the European Black Sea coast as well as in the Middle East [13-15]. In addition, viruses of this clade have caused major outbreaks among poultry in several Western African countries with ongoing virus circulation to date [16]. Interestingly, 2.3.2.1c viruses have not (yet) been reported from Egypt. Since 2010, another gs/GD cluster, termed 2.3.4.4, has evolved in eastern China and on the Korean peninsula [17]. These viruses have revealed a strong propensity to reassort with other influenza subtypes giving rise to novel HPAI sub- and genotypes including influenza A(H5N6) and A(H5N8). The latter subtype has proven to be highly mobile and was carried by infected wild birds to Europe and the North American continent in late 2014 [8,18]. In November 2016, HPAI H5N8 viruses of the 2.3.4.4 clade re-emerged on a large scale in wild birds in several central European countries and caused considerable mortality especially among diving duck species; sporadic incursions into poultry holdings were documented as well [19]. At the same time, this lineage was also detected in poultry in Israel [20].

Eurasian-origin LPAI subtype H5 viruses distantly related to the gs/GD lineage are routinely detected in aquatic wild bird populations with peak incidences during the autumn migration period [21]. Spillover of LPAI virus into poultry may cause notifiable outbreaks and bears the risk of the de novo generation of HP phenotypes following spontaneous mutations [3]. No human LPAI H5 virus infections have been reported so far.

Continuous co-circulation in poultry and sporadic spillover into migratory wild bird populations of different endemic HPAI H5 virus lineages poses constant risks of new incursions into Europe by migrating wild birds or in association with (illegal) poultry trading practices [9]. Furthermore, co-circulation of various HPAI lineages with different antigenic properties potentiates problems of control and eradication. Given the zoonotic propensities of some of the H5 viruses, tight control of infections in poultry is essential to curtail risks of human infections and further spread [22,23]. Molecular diagnosis including patho- and phylotyping of the relevant AIV is an important prerequisite for effective control measures.

We developed rapid diagnostic solutions on the basis of quantitative reverse transcription real-time PCR assays (RT-qPCR), to pathotype, without sequencing, gs/GD lineage HPAI and Eurasian LPAI H5 subtype viruses, and to distinguish HPAI gs/GD viruses of clades 2.2.1.2, 2.3.2.1 and 2.3.4.4, including viruses of the ongoing 2016 epizootic in Europe.

Methods

Virus isolates and clinical samples

A total of 24 reference virus isolates were obtained from the virus repositories at the Friedrich Loeffler Institute, Greifswald-Riems, Germany, or were provided by the National Laboratory for quality control on poultry production in Giza, Egypt, and by the Central Veterinary Research Laboratory (CVRL) in Dubai, United Arab Emirates (see also first table under Results).

Moreover, 106 field samples were included. These were obtained from holdings of different poultry sectors and wild birds from countries in Western Europe (Germany), the Middle East (Egypt, Iraq, United Arab Emirates) and Western Africa (Burkina Faso, Cameroon, Ghana, Ivory Coast, Niger), for HPAI viruses in the period between 2013 and 2016. Samples consisted mainly of oropharyngeal and/or cloacal swabs and tissues samples (n = 70) or AIV isolated from such samples (n = 36) (see also second table under Results).

A subsection of the 106 clinical samples (n = 13) was provided as dried material on Whatman FTA card (Sigma Aldrich, Germany). Samples from Western African countries were exclusively assayed at the Istituto Zooprofilattico Sperimentale delle Venezie, Padua, Italy.

Design of primers and probes

Primers were chosen based on alignments of the HA H5 gene of a selection of influenza A virus sequences submitted over the past 10 years to GenBank at the National Center for Biotechnology Information (NCBI) or to the EpiFlu database of the Global Initiative on Sharing Avian Influenza Data (GISAID). Selected sequences represented Eurasian LP viruses and HP isolates and clades of the gs/GD lineage that were detected in Europe, the Middle East and Western Africa during the past decade. Selection of primers to amplify a small fragment of the HA gene spanning the endoproteolytic cleavage site aimed at being broadly inclusive so as to target as many of the published LP Eurasian H5 HA sequences as possible and to distinguish them from HP viruses of the gs/GD lineage. The probes were placed directly onto the cleavage site in the attempt to specifically bind to sequences encoding either mono- or polybasic patterns that distinguish LP and HP pathotypes, respectively (Table 1).

Table 1

Primers and probes designed for differentiating pathotype and phylotype of Eurasian wild bird and goose/Guangdong origin potentially zoonotic avian influenza A subtype H5 viruses


Primer/Probe ID Target Sequence (5’ to 3’) Location Amplicon
size
Accession numbera
H5_HP_EA_F1 HPAI H5 CCTTGCDACTGGRCTCAG 984–1001 109 EPI647540
H5_HP_EA_F2 TCCTTGCAACAGGACTAAG 983–1001
H5_HP_EA_probe FAM- AAGAARAAARAGAGGACTRTTTGGAGCT-BHQ-1 1023–1050
H5_HP_EA_R GTCTACCATTCCYTGCCA 1092–1075
H5LP-EA_F LPAI H5 CCCAAATACGTGAAATCAGAT 955–975 133 EPI356413
H5LP1_EA_probe FAM-CCAAATAGYCCTCTYGTYTCT-BHQ-1 1052–1072
H5LP-EA_R GCC ACC CTC CTT CTA TAA AG 1088–1069
H5_2.2.1.2_Fw Clade 2.2.1.2 CATTTTGAGAAAATTCAGATCATT 376–399 161 EPI573250
H5_2.2.1.2_probe FAM-TCCATACCARGGAAGATCCTCCTTT-BHQ-1 451–474
H5_2.2.1.2_Rev GGTATGCATCGTTCTTTTTGG 537–517
H5_2.3.2.1_F Clade 2.3.2.1 GAGATTGGTACCAAAAATAGCC 669–690 146 EPI603577
H5_2.3.2.1_probe FAM-ACGGGCAAAGTGGCAGGATAGATTTC-BHQ-1 707–732
H5_2.3.2.1_R CAATGAAATTTCCATTACTCTCG 815–793
H5_2.3.4.4_F_A Clade 2.3.4.4 ATACCAGGGAGCATCCTCA 484–502 114 EPI554605
H5_2.3.4.4_F_B ATACCAGGGAACGCCCTCC 484–502
H5_2.3.4.4_probe FAM-TCGTTCTTTTTGATGAGCCATACCACA-BHQ-1 540–560
H5_2.3.4.4_R_A ATTATTGTAGCTTATCTTTATTGTC 598–574
H5_2.3.4.4_R_B ATTATTGTAGCTTATCTTTATTGTT 598–574

gs/GD: goose/Guangdong; HA: haemagglutinin; ID: identity.

a Accession number used to describe the position of the oligonucleotide along the HA gene. Sequences were obtained from GenBank at the National Center for Biotechnology Information (NCBI) or the EpiFlu database of the Global Initiative on Sharing Avian Influenza Data (GISAID).

At first, sets of primers and probes were designed to detect and discriminate between HP and LP biotypes, i.e. Eurasian H5 viruses encoding a monobasic or a polybasic HA cleavage site. In addition, four different sets of primers and probes were developed to differentiate between gs/GD clades 2.2.1.2, 2.3.2.1 and 2.3.4.4 (A and B). Pre-selected primers were then screened in silico for their specificity properties using Shannon entropy plots implemented in the Entropy One software (http://www.hiv.lanl.gov/content/sequence/-ENTROPY/entropy_one.html). Oligont (oligont) were selected so as to retain full specificity for the selected clade and to maximise entropy against all other clades. Basic physical properties of oligont were checked using the online web interface Oligo Calculator version 3.27. The finally chosen oligont are shown in Table 1. Detailed results of the in silico analyses are available on request from the authors.

One-step quantitative reverse transcription PCR assays

All reactions were performed using the AgPath-ID One-Step RT-qPCR kit (Thermofisher, scientific, United States) as follows: Reverse transcription at 45 °C for 10 min, initial denaturation at 95 °C for 10 min, 40 cycles of PCR amplification at 95 °C for 30 s, 58 °C for 15 s, and 72 °C for 15 s in a 25 µl reaction mixture using 15 pmol of each forward and reverse primers and 5 pmol probe per reaction. For each parameter a separate reaction was used. Cycling was performed on a Biorad CFX96 Real-Time cycler (BioRad, Germany). Fluorescent signals were collected during the annealing phase, and the amplification data were analysed using Bio-Rad CFX Manager 3 software accessing automated fluorescence drift correction for baseline adjustment.

Nucleotide sequencing and clade assignment

Patho- and phylotyping results obtained by newly developed RT-qPCRs were counter-checked by nt (nt) sequencing of the entire or parts of the HA gene of the respective isolates/clinical samples. Amplification of the HA gene was performed using primers published previously [24] and primers recommended in the European Union Diagnostic Manual for AI in a one-step RT-PCR [25]. In addition, amplificates of the HPAI H5 and LPAI H5 RT-qPCRs were used for sequencing purposes as well. Products were size-separated in agarose gels, excised and purified using the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). Purified PCR products were used for cycle sequencing reactions (BigDye Terminator v1.1 Cycle Sequencing Kit, Applied Biosystems, California, United States) the products of which were purified using NucleoSEQ columns (Macherey-Nagel GmbH and Co, Düren, Germany) and sequenced on an ABI PRISM 3130 Genetic Analyzer (Life Technologies, Darmstadt, Germany).

For pathotyping, deduced amino acid sequences of the endoproteolytical cleavage site of the HA gene were inspected and compared with the molecular pathotyping database provided by OFFLU [26]. Assignment of nt sequences to the gs/GD HPAI H5 virus clade system was performed by use of clade prediction tool implemented in the Influenza Research Database [27].

Results

Analytical specificity of pathotyping and phylotyping quantitative reverse transcription PCR assays

The specificity of the assays was evaluated with viral RNA from representative influenza A subtype H5 viruses that had been phylotyped based on full-length HA nt sequence analysis (Table 2). Furthermore, non-H5 subtypes, i.e. H9N2 and H7N7, as well as non-influenza avian viruses i.e. avian infectious bronchitis virus (IBV) and Newcastle disease virus (NDV) were employed (Table 2), and none of them was detected by any of the specific PCRs.

Table 2

Reference viruses used to determine analytical specificity of five PCR assays to detect potentially zoonotic avian influenza subtype H5 viruses


Reference virus Accession number of HAa Patho- and
Phylotype
PCR method b
HPAI H5 LPAI H5 Clade 2.2.1.2 Clade 2.3.2.1 Clade 2.3.4.4
1 A/turkey/Turkey/1/2005 (H5N1) KF042153 HP Clade 2.2 Pos Neg Pos Neg Neg
2 A/chicken/Egypt/0879-NLQP/R737/2008 (H5N1) GQ184238 HP Clade 2.2.1.1 Pos Neg Neg Neg Neg
3 A/chicken/Egypt/NLQP7FL-AR747/ 2013 (H5N1) EPI557170 HP Clade 2.2.1.2 Pos Neg Pos Neg Neg
4 A/duck/Egypt/AR236-A3NLQP/2015 (H5N1) EPI573260 HP Clade 2.2.1.2 Pos Neg Pos Neg Neg
5 A/turkey/Egypt/AR238-SD177NLQP/2014 (H5N1) EPI573268 HP Clade 2.2.1.2 Pos Neg Pos Neg Neg
6 A/peregrine falcon/Dubai/AR3430/2014 (H5N1) EPI603553 HP Clade 2.3.2.1c Pos Neg Neg Pos Neg
7 A/quail/Dubai/AR3445–2504.3/2014 (H5N1) EPI603577 HP Clade 2.3.2.1c Pos Neg Neg Pos Neg
8 A/duck/Bangladesh/D3-AR2111/2013 (H5N1) SAc HP Clade 2.3.2.1a Pos Neg Neg Pos Neg
9 A/turkey/Germany/AR2485–86/2014 (H5N8) EPI552746 HP Clade 2.3.4.4a Pos Neg Neg Neg Pos
10 A/turkey/Germany-MV/AR2472/2014 (H5N8) EPI544756 HP Clade 2.3.4.4a Pos Neg Neg Neg Pos
11 A/tufted duck/Germany/AR8444/2016 (H5N8) EPI859212 HP Clade 2.3.4.4b Pos Neg Neg Neg Pos
12 A/chicken/Indonesia/R132/2004 (H5N1) EPI354072 HP Clade 2.1.1 Pos Neg Neg Neg Neg
13 A/chicken/Indonesia/R134/2003 (H5N1) AM183669 HP Clade 2.1.1 Pos Neg Neg Neg Neg
14 A/chicken/Indonesia/R60/2005 (H5N1) AM183670 HP Clade 2.1.1 Pos Neg Neg Neg Neg
15 A/Vietnam/1194/2004 (H5N1) GQ149236 HP Clade 1.1 Pos Neg Neg Neg Neg
16 A/chicken/GXLA/1204/2004 (H5N1) AM183671 HP Clade 2.4 Pos Neg Neg Neg Neg
17 A/chicken/Vietnam/P41/2005 (H5N1) AM183672 HP Clade 1.1 Pos Neg Neg Neg Neg
18 A/chicken/Vietnam/P78/2005 (H5N1) AM183673 HP Clade 1.1 Pos Neg Neg Neg Neg
19 A/common teal/Germany/Wv1378–79/2003 (H5N2) HF563058 LP Neg Pos Neg Neg Neg
20 A/duck/Germany/R1789/2008 (H5N3) CY107849 LP Neg Pos Neg Neg Neg
21 A/turkey/Germany/AR915/2015 (H7N7) SAc H7N7 Neg Neg Neg Neg Neg
22 A/chicken/Egypt/AR754–14/2013 (H9N2) EPI557457 H9N2 Neg Neg Neg Neg Neg
23 A/chicken/Sudan/AR251–15/2014 (IBV) KX272465 IBV Neg Neg Neg Neg Neg
24 A/chicken/Egypt/AR254–15/2014 (NDV) SAc NDV Neg Neg Neg Neg Neg

Cq: cycle of quantification; HA: haemagglutinin; HP: highly pathogenic; HPAI: highly pathogenic avian influenza; IBV: infectious bronchitis virus; LP: low pathogenic; LPAI: low pathogenic avian influenza; NDV: Newcastle disease virus; Neg: negative; Pos: positive; RT-qPCR: quantitative reverse transcription PCR; SA: sequences available.

a Sequences were obtained from GenBank at the National Center for Biotechnology Information (NCBI) or the EpiFlu database of the Global Initiative on Sharing Avian Influenza Data (GISAID).

b Positive results: Cq value in similar range as with influenza A virus generic M RT-qPCR; negative results: Cq > 40. 
c Sequenced in the frame of the current study; sequences available from the authors upon request.

In the initial evaluation of the specificity of the pathotyping RT-qPCR assays carried out using two reference viruses: HPAI A/chicken/Egypt/AR236/2015 (H5N1, clade 2.2.1.2) and LPAI A/turkey/Germany/R2025/2008 (H5N3), specific reactivity exclusively with the homo-pathotypic virus was evident. In a second step, assays were extended to the full range of 24 reference viruses yielding a similar sharp distinction between HP and LP cleavage sites (Table 2).

Primers and probes for phylotyping RT-qPCR assays distinguishing three clades of gs/GD origin HPAIV H5 were placed within the HA1-fragment of the HA gene. This region encodes the receptor binding unit and harbours a number of neutralisation-relevant epitopes that are targets of antigenic drift. Hence, the HA1 fragment harbours regions that are the least conserved within the influenza A virus genome. Primer selection aimed at the inclusion of as many as possible distinguishing nt that would define exclusivity at the five most 3’ positions while probes were placed so as to accommodate distinguishing nt in the centre of the oligont. In order not to compromise amplification efficacy, amplicon size was limited to 130 nt wherever possible given the above mentioned constraints for primers and probes. The finally chosen oligont are listed in Table 1 and provided specific detection exclusively of the homologous clade. No cross-reactivity among the other gs/GD clades examined was evident on basis of the used panel of reference viruses (Table 2). Also, no cross-reactivity was detected for any of the five assays against other influenza A viruses or other avian viral respiratory pathogens (Table 2).

Validation of the analytical sensitivity, limit of detection and precision

Detection limits of the assays were determined by testing 10-fold serial dilutions of viral RNA extracted from representative viruses of each of the three HPAI virus clades (2.2.1.2, 2.3.2.1 and 2.3.4.4), and of Eurasian H5 LPAI virus. Cycle of quantification (Cq) values were compared with a standard RT-qPCR for the matrix (M) gene of these viruses with a reported detection limit of 2 to 20 RNA copies/5 µl [28]. Average values of three separate runs were computed and plotted using SigmaPlot V 11 software. Plotting these values revealed a linear relationship between the log of the viral RNA dilution and the Cq value for all assays and the kinetics of the assays and their sensitivity were determined to be very similar to the generic M gene RT-qPCR (M1.2 RT-qPCR [29]) (Figure 1).

Figure 1

Evaluation of detection limits and precision of pathotyping and phylotyping quantitative reverse transcription PCRs compared with a generic matrix (M) gene RT-qPCRa

/images/dynamic/articles/22681/16-00762-f1

Cq: cycle of quantification; HPAI: highly pathogenic avian influenza; LPAI: low pathogenic avian influenza; M: matrix; RT-qPCR: quantitative reverse transcription PCR.

The detection limit was determined based on triplicate analyses of serial 10-fold dilutions of target RNA of reference viruses: HPAI H5: A/duck/Egypt/AR236-A3NLQP/2015 (H5N1); LPAI H5: A/teal-Foehr/Wv1378–79/2003 (H5N2) (upper panel); HPAI H5 clade 2.2.1.2: A/duck/Egypt/AR236-A3NLQP/2015 (H5N1); clade 2.3.2.1: A/quail/Dubai/AR3445–2504.3/2014 (H5N1) and clade 2.3.4.4: A/turkey/Germany-MV/R2472/2014 (H5N8) (lower panel). A cut-off value of Cq 38 was chosen to calculate limits of detection and confidence intervals thereof.

a Described in [29].

The correlation coefficient of the standard curves was 0.99 for all assays, indicating a highly precise log–linear relationship between the viral RNA log dilution and the corresponding Cq-value (Figure 1). Based on these results the threshold distinguishing positive and negative was set at Cq = 38.

Pathotyping and phylotyping of clinical samples of potentially zoonotic Eurasian avian influenza A subtype H5 viruses by quantitative reverse transcription PCR

In order to evaluate the diagnostic performance capacity of the developed assays, field samples (RNA extracted from swabs, tissues or FTA cards) and clinical virus isolates obtained during the period 2013 to 2016 (HPAI viruses) or 2003 to 2015 (LPAI viruses) were examined. The sample set was preselected on basis of a positive generic M-specific RT-qPCR.

Among the final set of 106 samples, the pathotyping RT-qPCRs sharply discerned two groups of 69 samples reacting only in the new HPAI H5 RT-qPCR while 37 samples reacted positive in the LPAI H5 RT-qPCR (Figure 2a; Table 3).

Figure 2

Pathotyping and phylotyping of virus isolates and clinical samples of potentially zoonotic Eurasian avian influenza A subtype H5 viruses by quantitative reverse transcription PCRs

/images/dynamic/articles/22681/16-00762-f2

Cq: cycle of quantification; HPAI: highly pathogenic avian influenza; LPAI: low pathogenic avian influenza; M: matrix; RT-qPCR: quantitative reverse transcription PCR.

Sample numbers in A and B refer to Table 3. Cq values obtained for each sample by M1.2 RT-qPCR are shown as black dots (panels A and B); Cq values obtained for each sample by the specific RT-qPCRs are depicted as follows: Panel A red lozenges – HPAI H5, green crosses - LPAI H5; panel B blue lozenges - clade 2.2.1.2, purple triangles - clade 2.3.2.1, ochre Xs - clade 2.3.4.4.; panel C compares categorised Cq values obtained for all samples by M1.2 RT-qPCR (black box-and-whiskers) and the specific RT-qPCRs (colours as described for panels A and B).

Table 3

Pathotyping and phylotyping of different potentially zoonotic HPAI and LPAI influenza A subtype H5 virus isolates and field samples collected from poultry and wild bird species in different countries, 2013–2016


No. Sample ID Type of sample Accession Number a Clade PCR results
M1.2 HPAI H5 LPAI H5 2.2.1.2 2.3.2.1 2.3.4.4
1 A/chicken/Egypt/NLQP33SD-AR748/2013 Isolate EPI557178 HP 2.2.1.2 27.25 30.72 Neg 27.43 Neg Neg
2 A/chicken/Egypt/NLQP2AL-AR749/2013 Isolate EPI557186 HP 2.2.1.2 27.65 30.53 35.56 27.94 Neg Neg
3 A/duck/Egypt/NLQP27SG-AR750/2013 Isolate EPI557194 HP 2.2.1.2 28.01 30.01 Neg 27.41 Neg Neg
4 A/chicken/Egypt/NLQP639V-AR752/2013 Isolate EPI557202 HP 2.2.1.2 24.11 29.58 Neg 23.32 Neg Neg
5 A/chicken/Egypt/NLQP20SL-AR751/2013 Isolate EPI557210 HP 2.2.1.2 28.90 32.90 Neg 29.30 Neg Neg
6 A/chicken/Egypt/NLQP139V-AR753/2013 Isolate EPI557218 HP 2.2.1.2 33.32 34.13 Neg 33.51 Neg Neg
7 A/quail/Egypt/BSU5514-AR2219/2014 Field sample EPI557138 HP 2.2.1.2 15.12 22.12 Neg 15.47 Neg Neg
8 A/chicken/Egypt/AR234-FAOF8NLQP/2014 Field sample EPI573250 HP 2.2.1.2 28.60 31.95 Neg 28.75 Neg Neg
9 A/turkey/Egypt/AR235-S240NLQP/2014 Field sample EPI573252 HP 2.2.1.2 22.56 27.94 35.77 22.16 Neg Neg
10 A/chicken/Egypt/AR3690A/2016 Field sample SAb HP 2.2.1.2 18.01 18.97 35.29 18.61 Neg Neg
11 A/chicken/Egypt/AR3706/2016 Field sample SAb HP 2.2.1.2 19.27 22.98 Neg 20.13 Neg Neg
12 A/chicken/Egypt/AR3707/2016 Field sample SAb HP 2.2.1.2 23.39 27.66 Neg 23.71 Neg Neg
13 A/chicken/Egypt/AR3737/2016 Field sample SAb HP 2.2.1.2 19.53 24.16 Neg 20.58 Neg Neg
14 A/chicken/Egypt/AR3741/2016 Field sample SAb HP 2.2.1.2 20.25 23.08 35.04 21.71 Neg Neg
15 A/chicken/Egypt/AR3753/2016 Field sample SAb HP 2.2.1.2 21.22 26.21 35.55 23.10 Neg Neg
16 A/seagull/Dubai/AR3443–2504.1/2014 Isolate EPI603554 HP 2.3.2.1 15.62 16.32 Neg Neg 15.72 Neg
17 A/stone curlew/Dubai/AR3444–2504.2/2014 Isolate EPI603569 HP 2.3.2.1 13.81 14.72 Neg Neg 14.70 Neg
18 A/duck/Ivory_Coast/15VIR2742–1/2015 Spleen and caecum NA HP 2.3.2.1 31.79 23.56 Neg Neg 23.93 Neg
19 A/chicken/Ghana/15VIR2588–4/2015 Spleen KU97137 HP 2.3.2.1 22.72 24.47 Neg Neg 18.07 Neg
20 A/chicken/Ghana/15VIR2588–10/2015 Cloacal swab KU971357 HP 2.3.2.1 26.24 26.80 Neg Neg 24.61 Neg
21 A/chicken/Niger/15VIR2060–12/2015 Tracheal swab KU971309 HP 2.3.2.1 25.50 25.08 Neg Neg 24.37 Neg
22 A/chicken/Niger/15VIR2060–5/2015 Swab KU971326 HP 2.3.2.1 23.08 21.99 Neg Neg 20.35 Neg
23 A/domestic_bird/Burkina_Faso/15VIR1774–24/2015 Swab KU971508 HP 2.3.2.1 21.05 29.03 Neg Neg 24.01 Neg
24 A/domestic_bird/Burkina_Faso/15VIR1774–23/2015 Organ KU971500 HP 2.3.2.1 21.91 30.83 Neg Neg 24.72 Neg
25 A/chicken/Ghana/16VIR-4304–1/2016 Organ SAb HP 2.3.2.1 23.37 22.49 Neg Neg 18.44 Neg
26 A/chicken/Ghana/16VIR-4304–25/2016 Organ SAb HP 2.3.2.1 15.51 15.62 Neg Neg 12.09 Neg
27 A/chicken/Ghana/16VIR-4304–42/2016 Organ SAb HP 2.3.2.1 24.22 20.45 Neg Neg 18.28 Neg
28 A/chicken/Ghana/16VIR-4304–9/2016 Organ SAb HP 2.3.2.1 21.79 21.90 Neg Neg 19.13 Neg
29 A/duck/Cameroon/16VIR-3791–21/2016 Lung and trachea SAb HP 2.3.2.1 23.00 18.14 Neg Neg 17.98 Neg
30 A/chicken/Iraq/AR5282/2016 Field sample NA HP 2.3.2.1 28.78 28.20 Neg Neg 29.57 Neg
31 A/chicken/ Iraq/AR5283/2016 Field sample NA HP 2.3.2.1 31.70 31.12 Neg Neg 35.02 Neg
32 A/chicken/Iraq/AR5286/2016 Field sample SAb HP 2.3.2.1 28.21 28.10 36.50 Neg 28.16 Neg
33 A/chicken/Iraq/AR5287/2016 Field sample SAb HP 2.3.2.1 28.05 27.08 Neg Neg 26.80 Neg
34 A/chicken/Iraq/AR5291/2016 Field sample SAb HP 2.3.2.1 29.29 29.09 Neg Neg 28.09 Neg
35 A/chicken/Iraq/AR5292/2016 Field sample NA HP 2.3.2.1 30.83 30.28 36.32 Neg 31.15 Neg
36 A/chicken/Iraq/AR5296/2016 Field sample SAb HP 2.3.2.1 28.60 28.21 Neg Neg 28.53 Neg
37 A/turkey/Germany/AR2499/2014 Field sample SAb HP 2.3.4.4 27.78 26.48 36.71 Neg Neg 24.61
38 A/turkey/Germany/AR2500/2014 Field sample SAb HP 2.3.4.4 29.59 27.44 Neg Neg Neg 25.20
39 A/turkey/Germany/AR2501/2014 Field sample SAb HP 2.3.4.4 32.21 30.65 Neg Neg Neg 28.30
40 A/turkey/Germany/AR2502/2014 Field sample SAb HP 2.3.4.4 30.08 27.92 Neg Neg Neg 25.67
41 A/turkey/Germany/AR2503/2014 Field sample SAb HP 2.3.4.4 30.52 28.21 Neg Neg Neg 25.92
42 A/turkey/Germany/AR2562/2014 Field sample SAb HP 2.3.4.4 26.15 25.02 36.88 Neg Neg 25.21
43 A/turkey/Germany/AR2574/2014 Field sample SAb HP 2.3.4.4 27.49 30.23 36.36 Neg Neg 28.01
44 A/turkey/Germany/AR2591/2014 Field sample SAb HP 2.3.4.4 28.09 30.06 37.13 Neg Neg 28.57
45 A/teal/Germany/AR2917/2014 Field sample SAb HP 2.3.4.4 31.60 30.08 36.82 Neg Neg 35.41
46 A/turkey/Germany/AR3372/2014 Field sample EPI553172 HP 2.3.4.4 26.33 24.85 Neg Neg Neg 23.07
47 A/turkey/Germany/AR3376/2014 Field sample SAb HP 2.3.4.4 26.39 25.10 Neg Neg Neg 23.12
48 A/turkey/Germany/AR3381/2014 Field sample SAb HP 2.3.4.4 26.85 25.26 Neg Neg Neg 23.40
49 A/turkey/Germany/AR3382/2014 Field sample SAb HP 2.3.4.4 27.64 26.18 Neg Neg Neg 24.18
50 A/turkey/Germany/AR3383/2014 Field sample SAb HP 2.3.4.4 29.26 28.13 Neg Neg Neg 26.06
51 A/duck/Germany/AR3457/2014 Field sample SAb HP 2.3.4.4 30.29 29.30 Neg Neg Neg 28.34
52 A/duck/Germany/AR3465/2014 Field sample SAb HP 2.3.4.4 23.98 23.15 Neg Neg Neg 20.70
53 A/duck/Germany/AR3470/2014 Field sample SAb HP 2.3.4.4 22.15 23.89 Neg Neg Neg 21.78
54 A/wild-duck/Germany/AR8603/2016 Field sample SAb HP 2.3.4.4b 22.51 22.90 Neg Neg Neg 21.14
55 A/greyleg goose /Germany/AR8604/2016 Field sample SAb HP 2.3.4.4b 22.41 22.30 Neg Neg Neg 20.26
56 A/greater scaup/Germany/AR9090/2016 Field sample SAb HP 2.3.4.4b 27.29 31.71 Neg Neg Neg 29.61
57 A/greater scaup/Germany/AR9091/2016 Field sample SAb HP 2.3.4.4b 28.95 34.40 Neg Neg Neg 31.74
58 A/greater scaup/Germany/AR9092/2016 Field sample SAb HP 2.3.4.4b 23.85 25.70 Neg Neg Neg 26.05
59 A/grey heron/Germany/AR9093/2016 Field sample SAb HP 2.3.4.4b 20.10 22.62 Neg Neg Neg 22.44
60 A/greater scaup/Germany/AR9094/2016 Field sample SAb HP 2.3.4.4b 16.31 20.62 Neg Neg Neg 18.92
61 A/greater scaup/Germany/AR9095/2016 Field sample SAb HP 2.3.4.4b 20.99 22.79 Neg Neg Neg 21.75
62 A/northern pintail /Germany/AR9096/2016 Field sample SAb HP 2.3.4.4b 22.83 28.12 Neg Neg Neg 23.95
63 A/bean goose/Germany/AR9097/2016 Field sample SAb HP 2.3.4.4b 22.97 24.88 Neg Neg Neg 24.92
64 A/herring gull /Germany/AR9098/2016 Field sample SAb HP 2.3.4.4b 20.40 22.35 Neg Neg Neg 23.64
65 A/mute swan/Germany/AR9099/2016 Field sample SAb HP 2.3.4.4b 21.12 25.83 Neg Neg Neg 22.75
66 A/chicken/Germany/AR9140/2016 Field sample SAb HP 2.3.4.4b 21.08 20.55 Neg Neg Neg 22.92
67 A/chicken/Germany/AR9141/2016 Field sample SAb HP 2.3.4.4b 21.21 20.13 Neg Neg Neg 23.12
68 A/chicken/Germany/AR9143/2016 Field sample SAb HP 2.3.4.4b 32.27 31.51 Neg Neg Neg 35.49
69 A/chicken/Germany/AR9144/2016 Field sample SAb HP 2.3.4.4b 21.89 20.89 Neg Neg Neg 25.92
70 A/chicken/Italy/22/1998 Isolate CAP58165 LPAI H5N9 12.34 Neg 19.06 Neg Neg Neg
71 A/mallard/Germany/Wv1349–51K/2003 Isolate CAP58164 LPAI H5N3 26.00 Neg 14.79 Neg Neg Neg
72 A/mallard/Germany/Wv476/2004 Isolate NA LPAI H5N2 29.87 Neg 29.5 Neg Neg Neg
73 A/mallard/Germany/Wv474–77K/2004 Isolate NA LPAI H5N2 29.64 Neg 34.81 Neg Neg Neg
74 A/ostrich/Germany/R5–10/2006 Isolate HF563057 LPAI H5N3 26.80 Neg 26.19 Neg Neg Neg
75 A/mallard/Germany/R2557/2006 Isolate NA LPAI H5N3 26.24 Neg 27.61 Neg Neg Neg
76 A/mallard/Germany/R731/2008 Isolate SAb LPAI H5N3 30.36 Neg 32.30 Neg Neg Neg
77 A/mallard/Germany/R771/2008 Isolate SAb LPAI H5N3 29.24 Neg 30.28 Neg Neg Neg
78 A/mallard/Germany/R772/2008 Isolate SAb LPAI H5N3 23.68 Neg 24.50 Neg Neg Neg
79 A/turkey/Germany/R1550/2008 Isolate NA LPAI H5N3 25.17 Neg 26.22 Neg Neg Neg
80 A/turkey/Germany/R1551/2008 Isolate NA LPAI H5N3 24.03 Neg 24.91 Neg Neg Neg
81 A/turkey/Germany/R1557/2008 Isolate SAb a LPAI H5N3 23.50 Neg 24.16 Neg Neg Neg
82 A/turkey/Germany/R1612/2008 Isolate NA LPAI H5N3 27.43 Neg 29.25 Neg Neg Neg
83 A/turkey/Germany/R2014/2008 Isolate SAb LPAI H5N3 24.33 Neg 21.99 Neg Neg Neg
84 A/turkey/Germany/R2015/2008 Isolate SAb LPAI H5N3 15.69 Neg 30.13 Neg Neg Neg
85 A/turkey/Germany/R2016/2008 Isolate SAb LPAI H5N3 18.13 Neg 15.96 Neg Neg Neg
86 A/turkey/Germany/R2017/2008 Isolate SAb LPAI H5N3 18.32 Neg 16.92 Neg Neg Neg
87 A/turkey/Germany/R2018/2008 Isolate SAb LPAI H5N3 14.16 Neg 16.05 Neg Neg Neg
88 A/turkey/Germany/R2019/2008 Isolate SAb LPAI H5N3 14.55 Neg 16.84 Neg Neg Neg
89 A/turkey/Germany/R2020/2008 Isolate SAb LPAI H5N3 19.38 Neg 16.73 Neg Neg Neg
90 A/turkey/Germany/R2021/2008 Isolate SAb LPAI H5N3 12.71 Neg 13.51 Neg Neg Neg
91 A/turkey/Germany/R2022/2008 Isolate SAb LPAI H5N3 12.63 Neg 13.18 Neg Neg Neg
92 A/turkey/Germany/R2023/2008 Isolate SAb LPAI H5N3 19.37 Neg 17.07 Neg Neg Neg
93 A/turkey/Germany/R2024/2008 Isolate SAb LPAI H5N3 22.52 Neg 20.39 Neg Neg Neg
94 A/turkey/Germany/R2025/2008 Isolate SAb LPAI H5N3 22.44 Neg 25.22 Neg Neg Neg
95 A/turkey/Germany/R2026/2008 Isolate SAb LPAI H5N3 14.70 Neg 16.26 Neg Neg Neg
96 A/turkey/Germany/R2027/2008 Isolate SAb LPAI H5N3 17.80 Neg 16.06 Neg Neg Neg
97 A/mallard/Germany/R2892–94/2009 Isolate EPI356412 LPAI H5N3 11.98 Neg 14.37 Neg Neg Neg
98 A/duck/Germany/AR1965/2013 Field sample NA LPAI H5N3 26.62 Neg 27.25 Neg Neg Neg
99 A/turkey/Germany/AR1892/1/2014 Field sample SAb LPAI H5N2 20.03 Neg 21.15 Neg Neg Neg
100 A/duck/Germany/AR1/2015 Field sample SAb LPAI H5N3 29.20 Neg 34.01 Neg Neg Neg
101 A/swan/Germany/AR111/2015 Field sample SAb LPAI H5N4 27.45 Neg 31.02 Neg Neg Neg
102 A/goose/Germany/AR398/2015 Field sample SAb LPAI 31.09 Neg 33.69 Neg Neg Neg
103 A/duck/Germany/AR1231/1/2015 Field sample NA LPAI H5N2 26.74 Neg 32.91 Neg Neg Neg
104 A/duck/Germany/AR2853/15–1/2015 Field sample SAb LPAI H5N3 27.06 Neg 26.25 Neg Neg Neg
105 A/goose/Germany/AR3264/1/2015 Field sample SAb LPAI H5N2 34.47 Neg 35.50 Neg Neg Neg
106 A/wild bird/Germany/AR221/2015 Field sample SAb LP H5N3 22.17 Neg 23.48 Neg Neg Neg

HA: haemagglutinin; HP: highly pathogenic; HPAI: highly pathogenic avian influenza; ID: identity; LP: low pathogenic; LPAI: low pathogenic avian influenza; NA: sequence not available; Neg: negative; SA: sequence available.

a Sequences were obtained from GenBank at the National Center for Biotechnology Information (NCBI) or the EpiFlu database of the Global Initiative on Sharing Avian Influenza Data (GISAID).

b Sequenced in the frame of the current study; sequences available from the authors upon request.

All pathotyping results matched the results obtained by nt sequence analysis of the HA cleavage site. However, in a few samples (two isolates, 10 clinical samples) of HP viruses, the LPAI H5 RT-qPCR also gave a weak positive signal (Cq > 35). Compared with the LPAI H5 signal the HPAI H5 signal of these samples yielded Cq values 6–10 units lower on average ascertaining good diagnostic specificity. Depending on the clade, the HP phenotype was detected with equal (clade 2.3.2.1) or slightly reduced (clade 2.2.1.2) sensitivity; the LP H5 RT-qPCR appeared to be slightly less sensitive than the M PCR as far as clinical samples were concerned (Table 3; Figure 2a and c). Sequences across the cleavage sites of these samples are presented in a supplemental alignment (Figure 2).

In a next step, the samples that were designated HPAI H5-positive were subjected to the three phylotyping RT-qPCRs. Here, 15, 21 and 33 samples, respectively, were exclusively positive for either clade 2.2.1.2, 2.3.2.1 or 2.3.4.4 (Table 3). Thus, a clear cut clade assignment was possible for all gs/GD HP H5 samples. Results were counterchecked by feeding available HA sequences of these samples into the IRD clade prediction tool (www.fludb.org/brc/h5n1-Classifier.spg?method=ShowCleanInputPage&decorator=influenz): In all cases the same clade was assigned by sequence analysis and by PCR. In a final step also all LPAI H5 samples were tested in the phylotyping RT-qPCRs and none of them cross-reacted. Regarding the sensitivity of these PCRs, the Cq values were compared with those of the generic M1.2-specific RT-qPCR (Figure 2b). For clade 2.2.1.2 and 2.3.2.1 the sensitivity was almost identical to the M PCR; for clade 2.3.4.4a, the clade-specific PCR proved to be slightly more sensitive while viruses of clade 2.3.4.4b were detected at a slightly lower sensitivity; detection of clade 2.3.4.4b viruses was slightly less sensitive than the M PCR (Figure 2b and c; Table 3) as far as clinical samples were concerned.

Rank Sum tests implemented in the SigmaPlot software package were performed and no statistically significant difference between the median Cq values of each specific assay and the M1.2 RT-qPCR assay was found (p > 0,50) indicating that the newly developed RT-qPCRs display similar analytical sensitivity. Thus, the phylotyping RT-qPCRs allow a sensitive and highly specific detection and distinction of the three major gs/GD clades currently circulating in countries where the viruses were obtained from.

Discussion

Rapid molecular diagnosis including patho- and phylotyping is basis to enable measures aimed at repressing the spread of potentially zoonotic HPAI viruses. The TaqMan PCR technology has proven reliable, versatile, and comparatively cost-effective in the generic detection and subtype differentiation of AIV [30]. Further differentiation of clades, lineages and pathotypes was previously nearly entirely based on nt sequencing approaches which require expensive equipment and are time consuming. In epidemiologically complex settings where different lineages and pathotypes of potentially zoonotic and notifiable infectious agents co-circulate, a more rapid and direct access to testing and results, e.g. by using RT-qPCRs, is desirable. Although RT-qPCRs are inferior to sequencing techniques in terms of retrievable data details, they are superior with respect to time-to-diagnosis and ease-of-use. This concept which we used earlier for pathotyping of H5N1 [31], was here further extended and refined for the identification and discrimination of avian influenza A subtype H5 viruses of different patho- and phylotypes. The focus was put on those clades of H5 viruses (2.2.1.2, 2.3.2.1, 2.3.4.4) that had previously ‘escaped’ from Asia and were detected in western parts of Eurasia and in Africa.

Pathotyping of avian influenza A subtype H5 viruses is mandatory from an animal health perspective. The pathotyping RT-qPCRs presented here reduce time-to-diagnosis to just three hours following sample receipt. To our knowledge this is the broadest and most detailed attempt of AIV pathotyping using RT-qPCR. The availability of highly sensitive pathotyping PCRs would also allow to detect mixtures of HP and LP H5 viruses in the same sample; in fact, some of our HP-positive field samples also gave weak LP signals (Table 3, sample numbers 2, 9, 10, 14, 15, 30, 32, 35, 37, 42–5). Yet, LPAI pathotypes in these samples were detected at distinctly higher Cq values indicating either a minor population in a quasispecies of different pathotypes or expressing some cross-reactivity of LPAI primers and probe; in any case, the detection of HPAI genotypes as a major population in a set of field samples was always unequivocal. Further insight into the true nature of these mixtures would only be unravelled by deep sequencing approaches of those samples.

Rapid pathotyping enables rapid implementation of appropriate measures to prevent further spread of virus such as closure of poultry holdings and/or live poultry markets, culling of infected flocks etc. This impedes accumulation of potentially zoonotic AIV at the poultry-human interface which in turn lowers the risks of human infection.

Phylotyping of gs/GD HPAI H5 virus clades is important since each clade, and often also sublineages thereof, display distinct antigenic and pathogenetic properties. This has direct implications, as by assigning the matching clade, appropriate vaccines that ensure the closest antigenic match with the circulating viruses can be selected [32,33]. In particular, countries where gs/GD viruses have become endemic in poultry populations, rely on vaccination of poultry on a broad scale to suppress circulating viruses and to limit risks of human exposure [23]. However, it should be noted that mutant escape variants within these clades selected by vaccine-induced population immunity will not be detected as such by the assays, and in fact, such mutants may also be detected at lower sensitivity if primer and/or probe binding sites are affected by mutations. Detection of variants will still depend on either nt sequencing or virus isolation/antigenic characterisation approaches but the newly developed assays will aid in selection of meaningful samples in this respect. In particular, samples that do not give conclusively similar Cq values in the generic and the specific assays should prompt in-depth analysis by nt sequencing.

It should be clearly stated that the assays presented here have limitations owed to the restricted geographical distribution of the targeted clades. The use of the newly developed PCRs in regions where viruses belonging to the targeted clades (2.2.1.2, 2.3.2.1c and 2.3.4.4) are reportedly absent is only recommended if immediate incursions with any of these clades are apprehended. Phylotyping indirectly may point towards zoonotic potential since different gs/GD lineages vary in their zoonotic propensity: Egyptian 2.2.1.2 viruses are characterised by increased affinity to human-like sialic acid receptors and have caused by far the largest number of human influenza A(H5N1) virus infections over the past decade [12]. For clade 2.3.2.1c viruses, repeatedly detected in the Middle East (excluding Egypt) and endemic in Western African countries, only few human cases have been recorded. The 2.3.4.4 viruses currently present in various parts of Europe have not provoked human infection so far [34].

Extended co-circulation of more than one gs/GD lineage in poultry and/or wild birds in a wider geographic region was repeatedly reported [35,36]. It is pivotal, for the above mentioned reasons, to detect incursions of distinct HPAI virus lineages in a timely manner. In this respect, the newly developed RT-qPCR assays were shown to be useful tools for an improved rapid and simple characterisation of patho- and phylotypes of Eurasian origin avian influenza A subtype H5 viruses. The assays aid in speeding up diagnosis on clinical samples because the time consuming (initial) need of virus isolation and nt sequencing is avoided. Given the high substitution rate of HP H5 influenza viruses frequent checks and, if required, updates of the primers and probes are recommended to ensure full specificity and sensitivity of the patho- and phylotyping RT-qPCRs. These PCRs are advantageous in particular for wild bird samples, especially those that contain LPAI viruses, often with low viral loads and therefore fail to yield replication-competent virus. With respect to HPAI virus, the renouncement from initial virus isolation improves biosecurity. However, the presented assays are not intended to replace virus isolation and antigenic characterisation as a means to detect emerging antigenic drift mutants. Nevertheless, they may aid in selection of appropriate samples for such tasks. Accurate phylotyping also facilitates selection of appropriate vaccines as it serves as an early warning for the incursion of new and antigenically possibly distinct phylotypes.

Conclusions

The assays reported here are primarily intended for screening purposes of avian samples; confirmatory assays, including nt sequence analyses and antigenic characterisation, are still required for new incursions and outbreak scenarios that feature an expansion of the geographic area and/or the range of affected species or poultry sectors. When used in the frame of on-going outbreaks, in particular in regions where vaccination is not used as a preventive measure, results of the patho- and phylotyping PCRs are deemed solid enough for reporting purposes and to justify the implementation of restriction measures. In such settings, similar to the current outbreaks of clade 2.3.4.4b HP H5N8 in Europe, the assays can be prioritised to running the HP and only one (i.e. the fitting) of the phylotyping PCRs on M1.2- and H5 PCR-positive samples. This significantly speeds up time-to-diagnosis and reduces reaction times in a OneHealth approach of repressing the spread of gs/GD HP AIV. Sequencing facilities, classically required for patho- and phylotyping, may not be available, and even not logistically accessible in many regions severely affected by H5 HPAI incursions. The prospect of having sequencing-independent, TaqMan-based specific and sensitive typing assays, as described here, available in developing regions is expected to boost regional diagnostic capacities eventually leading to improved disease control.


Acknowledgements

The authors greatly acknowledge Dr Joseph Adongo Awuni from Accra Veterinary Laboratory, Veterinary Services Directorate, Ministry of Food and Agriculture, Accra (Ghana), Dr Germaine L. Minoungou from the Laboratoire National d'Elevage in Ouagadougou (Burkina Faso), Dr Zangui Ibrahima Mahaman Sani and Dr Abdou Alassane from the LABOCEL - Laboratoire Central de l'Elevage, Niamey (Niger), Dr Emmanuel Couacy-Hymann from the Laboratoire Central de Pathologie Animale, Bingerville (Côte d'Ivoire) and Abel Wade from the National Veterinary Laboratory (LANAVET), Yaounde (Cameroon) for submitting samples to the Istituto Zooprofilattico Sperimentale delle Venezie, Padova, Italy and for their interest in collaborating in the validation of the developed real-time RT-PCR assays. Field samples from Ghana, Côte d'Ivoire, Cameroon, Niger, Burkina Faso used to evaluate the diagnostic performance capacity of the developed assays were obtained through technical support provided by the United Nations Food and Agriculture Organisation (letter of agreement number 321149).

We wish to thank Aline Maksimov and Diana Wessler for excellent technical support. We are grateful to veterinarians and diagnosticians in Germany for submitting diagnostic samples.

We also gratefully acknowledge the authors, originating and submitting laboratories of the sequences from GISAID’s EpiFlu Database used in this study; a detailed list of the respective sequences from the EpiFlu database is available on request from the authors.

Conflict of interest

None declared. One of the authors (N.A.) works for Boehringer Ingelheim, Dubai, United Arab Emirates.

Authors’ contributions

Mahmoud M. Naguib, Annika Graaf and Timm Harder conceived the study. Andrea Fortin, Ulrich Wernery, Nadim Amarin, Hussein A. Hussein, Hesham Sultan and Basem Al Adhadh were involved in the collection, initial analysis and provision of viruses and field samples. Christine Luttermann conducted the Sanger sequencing analyses. Mahmoud M. Naguib, Annika Graaf and Andrea Fortin produced, analysed and interpreted data. Timm Harder and Mahmoud M. Naguib drafted the manuscript. Isabella Monne, Martin Beer and all co-authors critically analysed and revised the manuscript and provided final approval.


References

  1. Cheung TK, Poon LL. Biology of influenza a virus.Ann N Y Acad Sci. 2007;1102(1):1-25. DOI: 10.1196/annals.1408.001 PMID: 17470908

  2. Webster RG, Govorkova EA. Continuing challenges in influenza.Ann N Y Acad Sci. 2014;1323(1):115-39. DOI: 10.1111/nyas.12462 PMID: 24891213

  3. França MS, Brown JD. Influenza pathobiology and pathogenesis in avian species.Curr Top Microbiol Immunol. 2014;385:221-42. DOI: 10.1007/82_2014_385 PMID: 25015786

  4. Wallace RG, Bergmann L, Kock R, Gilbert M, Hogerwerf L, Wallace R,  et al.  The dawn of Structural One Health: a new science tracking disease emergence along circuits of capital. Soc Sci Med. 2015;129:68-77. DOI: 10.1016/j.socscimed.2014.09.047 PMID: 25311784

  5. Malik Peiris JS. Avian influenza viruses in humans.Rev Sci Tech. 2009;28(1):161-73. DOI: 10.20506/rst.28.1.1871 PMID: 19618624

  6. Capua I, Munoz O. Emergence of influenza viruses with zoonotic potential: open issues which need to be addressed. A review.Vet Microbiol. 2013;165(1-2):7-12. DOI: 10.1016/j.vetmic.2013.01.044 PMID: 23567150

  7. Smith GJ, Donis RO. World Health Organization/World Organisation for Animal HF, Agriculture Organization HEWG. Nomenclature updates resulting from the evolution of avian influenza A(H5) virus clades 2.1.3.2a, 2.2.1, and 2.3.4 during 2013-2014.Influenza Other Respi Viruses. 2015;9(5):271-6. DOI: 10.1111/irv.12324

  8. Lycett S, Bodewes R, Pohlmann A, Banks J, Bányai K, Boni MF,  et al. , Global Consortium for H5N8 and Related Influenza Viruses. Role for migratory wild birds in the global spread of avian influenza H5N8.Science. 2016;354(6309):213-7. DOI: 10.1126/science.aaf8852 PMID: 27738169

  9. Adlhoch C, Gossner C, Koch G, Brown I, Bouwstra R, Verdonck F,  et al.  Comparing introduction to Europe of highly pathogenic avian influenza viruses A(H5N8) in 2014 and A(H5N1) in 2005. Euro Surveill. 2014;19(50):20996. DOI: 10.2807/1560-7917.ES2014.19.50.20996 PMID: 25597538

  10. Abdelwhab EM, Hassan MK, Abdel-Moneim AS, Naguib MM, Mostafa A, Hussein IT,  et al.  Introduction and enzootic of A/H5N1 in Egypt: Virus evolution, pathogenicity and vaccine efficacy ten years on. Infect Genet Evol. 2016;40:80-90. DOI: 10.1016/j.meegid.2016.02.023 PMID: 26917362

  11. World Health Organization (WHO). Cumulative number of confirmed human cases for avian influenza A(H5N1) reported to WHO, 2003-2016. Geneva: WHO; 2016. [Accessed 01 Jan 2017]. Available from: http://www.who.int/influenza/human_animal_interface/H5N1_cumulative_table_archives/en/.

  12. Arafa AS, Naguib MM, Luttermann C, Selim AA, Kilany WH, Hagag N,  et al.  Emergence of a novel cluster of influenza A(H5N1) virus clade 2.2.1.2 with putative human health impact in Egypt, 2014/15. Euro Surveill. 2015;20(13):2-8. DOI: 10.2807/1560-7917.ES2015.20.13.21085 PMID: 25860390

  13. Tosh C, Nagarajan S, Kumar M, Murugkar HV, Venkatesh G, Shukla S,  et al.  Multiple introductions of a reassortant H5N1 avian influenza virus of clade 2.3.2.1c with PB2 gene of H9N2 subtype into Indian poultry. Infect Genet Evol. 2016;43:173-8. DOI: 10.1016/j.meegid.2016.05.012 PMID: 27174088

  14. Bi Y, Chen J, Zhang Z, Li M, Cai T, Sharshov K,  et al.  Highly pathogenic avian influenza H5N1 Clade 2.3.2.1c virus in migratory birds, 2014-2015. Virol Sin. 2016;31(4):300-5. DOI: 10.1007/s12250-016-3750-4 PMID: 27405930

  15. Naguib MM, Kinne J, Chen H, Chan KH, Joseph S, Wong PC,  et al.  Outbreaks of highly pathogenic avian influenza H5N1 clade 2.3.2.1c in hunting falcons and kept wild birds in Dubai implicate intercontinental virus spread. J Gen Virol. 2015;96(11):3212-2. DOI: 10.1099/jgv.0.000274 PMID: 26350163

  16. Tassoni L, Fusaro A, Milani A, Lemey P, Awuni JA, Sedor VB,  et al.  Genetically Different Highly Pathogenic Avian Influenza A(H5N1) Viruses in West Africa, 2015. Emerg Infect Dis. 2016;22(12):2132-6. DOI: 10.3201/eid2212.160578 PMID: 27389972

  17. Claes F, Morzaria SP, Donis RO. Emergence and dissemination of clade 2.3.4.4 H5Nx influenza viruses-how is the Asian HPAI H5 lineage maintained.Curr Opin Virol. 2016;16:158-63. DOI: 10.1016/j.coviro.2016.02.005 PMID: 26991931

  18. Lee DH, Torchetti MK, Winker K, Ip HS, Song CS, Swayne DE. Intercontinental Spread of Asian-Origin H5N8 to North America through Beringia by Migratory Birds.J Virol. 2015;89(12):6521-4. DOI: 10.1128/JVI.00728-15 PMID: 25855748

  19. ProMED-mail. Avian influenza H5N8 Germany. Archive. 2016;4641281(: 20161119):19. Available from: http://www.promedmail.org/post/20161119.4641281

  20. ProMED-mail. Avian influenza H5N8 Israel. Archive. 2016;4628359(: 20161114):14. Available from: http://www.promedmail.org/post/4628359

  21. Munster VJ, Baas C, Lexmond P, Waldenström J, Wallensten A, Fransson T,  et al.  Spatial, temporal, and species variation in prevalence of influenza A viruses in wild migratory birds. PLoS Pathog. 2007;3(5):e61. DOI: 10.1371/journal.ppat.0030061 PMID: 17500589

  22. Peiris JS, Cowling BJ, Wu JT, Feng L, Guan Y, Yu H,  et al.  Interventions to reduce zoonotic and pandemic risks from avian influenza in Asia. Lancet Infect Dis. 2016;16(2):252-8. DOI: 10.1016/S1473-3099(15)00502-2 PMID: 26654122

  23. Sims LD. Intervention strategies to reduce the risk of zoonotic infection with avian influenza viruses: scientific basis, challenges and knowledge gaps.Influenza Other Respi Viruses. 2013;7(Suppl 2):15-25. DOI: 10.1111/irv.12076 PMID: 24034479

  24. Höper D, Hoffmann B, Beer M. Simple, sensitive, and swift sequencing of complete H5N1 avian influenza virus genomes.J Clin Microbiol. 2009;47(3):674-9. DOI: 10.1128/JCM.01028-08 PMID: 19109473

  25. European Commission (EC). 2006/437/EC: Commission Decision of 4 August 2006 approving a Diagnostic Manual for avian influenza as provided for in Council Directive 2005/94/EC (notified under document number C(2006) 3477) (Text with EEA relevance). OJ L 237, 31.8.2006, p. 1-27. Brussels: EC; 2006. Available from: http://eur-lex.europa.eu/legal-content/EN/TXT/?uri=CELEX%3A32006D0437

  26. World Organisation for Animal Health/Food and Agriculture Organization of the United Nations (OIE/FAO). Network of expertise on animal influenza. Influenza A Cleavage sites. Paris/Rome: OIE/FAO; 2015. [Accessed 01 Dec 2016] Available from: http://www.offlu.net/fileadmin/home/en/resource-centre/pdf/Influenza_A_Cleavage_Sites.pdf

  27. Influenza research database (IRD). [Internet]. Highly Pathogenic H5N1 Clade Classification Tool. [Accessed 21 Nov 2016]. Available from: https://www.fludb.org/brc/h5n1Classifier.spg?method=ShowCleanInputPage&decorator=influenza

  28. Hoffmann B, Harder T, Lange E, Kalthoff D, Reimann I, Grund C,  et al.  New real-time reverse transcriptase polymerase chain reactions facilitate detection and differentiation of novel A/H1N1 influenza virus in porcine and human samples. Berl Munch Tierarztl Wochenschr. 2010;123(7-8):286-92.PMID: 20690540

  29. Spackman E, Senne DA, Bulaga LL, Myers TJ, Perdue ML, Garber LP,  et al.  Development of real-time RT-PCR for the detection of avian influenza virus. Avian Dis. 2003;47(3) Suppl;1079-82. DOI: 10.1637/0005-2086-47.s3.1079 PMID: 14575115

  30. Hoffmann B, Hoffmann D, Henritzi D, Beer M, Harder TC. Riems influenza a typing array (RITA): An RT-qPCR-based low density array for subtyping avian and mammalian influenza a viruses.Sci Rep. 2016;6:27211. DOI: 10.1038/srep27211 PMID: 27256976

  31. Hoffmann B, Harder T, Starick E, Depner K, Werner O, Beer M. Rapid and highly sensitive pathotyping of avian influenza A H5N1 virus by using real-time reverse transcription-PCR.J Clin Microbiol. 2007;45(2):600-3. DOI: 10.1128/JCM.01681-06 PMID: 17182758

  32. Ampofo WK, Azziz-Baumgartner E, Bashir U, Cox NJ, Fasce R, Giovanni M,  et al. , WHO Writing Group. Strengthening the influenza vaccine virus selection and development process: Report of the 3rd WHO Informal Consultation for Improving Influenza Vaccine Virus Selection held at WHO headquarters, Geneva, Switzerland, 1-3 April 2014.Vaccine. 2015;33(36):4368-82. DOI: 10.1016/j.vaccine.2015.06.090 PMID: 26148877

  33. Wong S-S, Webby RJ. Traditional and new influenza vaccines.Clin Microbiol Rev. 2013;26(3):476-92. DOI: 10.1128/CMR.00097-12 PMID: 23824369

  34. European Centre for Disease Prevention and Control (ECDC). Outbreak of highly pathogenic avian influenza. A(H5N8) in Europe – 18 November 2016. Stockholm: ECDC; 2016. [Accessed 21 Nov 2016] Available from: http://ecdc.europa.eu/en/publications/Publications/risk-assessment-avian-influenza-H5N8-europe.pdf

  35. Kis Z, Jones J, Creanga A, Ferdinand K, Inui K, Gerloff N,  et al.  Real-time RT-PCR assay to differentiate clades of H5N1 avian influenza viruses circulating in Vietnam. J Virol Methods. 2013;193(2):452-8. DOI: 10.1016/j.jviromet.2013.06.023 PMID: 23850699

  36. Abdelwhab SM, Erfan AM, Grund C, Ziller M, Arafa A-S, Beer M,  et al.  Simultaneous detection and differentiation by multiplex real time RT-PCR of highly pathogenic avian influenza subtype H5N1 classic (clade 2.2.1 proper) and escape mutant (clade 2.2.1 variant) lineages in Egypt. Virol J. 2010;7(1):260. DOI: 10.1186/1743-422X-7-260 PMID: 20929539



Back to Table of Contents
Previous Download (pdf)
Next

The publisher’s policy on data collection and use of cookies.

Disclaimer: The opinions expressed by authors contributing to Eurosurveillance do not necessarily reflect the opinions of the European Centre for Disease Prevention and Control (ECDC) or the editorial team or the institutions with which the authors are affiliated. Neither ECDC nor any person acting on behalf of ECDC is responsible for the use that might be made of the information in this journal. The information provided on the Eurosurveillance site is designed to support, not replace, the relationship that exists between a patient/site visitor and his/her physician. Our website does not host any form of commercial advertisement. Except where otherwise stated, all manuscripts published after 1 January 2016 will be published under the Creative Commons Attribution (CC BY) licence. You are free to share and adapt the material, but you must give appropriate credit, provide a link to the licence, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.

Eurosurveillance [ISSN] - ©2007-2016. All rights reserved
 

This website is certified by Health On the Net Foundation. Click to verify. This site complies with the HONcode standard for trustworthy health information:
verify here.