Announcements
On 6 June 2017, the World Health Organization (WHO) published updates to its ‘Essential Medicines List’ (EML). Read more here.

Extended deadline (from 1 July to 31 July) 2017 for call to submit papers on effectiveness and cost-effectiveness of screening and prevention of infectious diseases among newly arrived migrants in Europe. Read more here.

Eurosurveillance is on the updated list of the Directory of Open Access Journals and in the SHERPA/RoMEO database. Read more here.

Follow Eurosurveillance on Twitter: @Eurosurveillanc


In this issue


Home Eurosurveillance Edition  2016: Volume 21/ Issue 27 Article 2
Back to Table of Contents
Previous Download (pdf)
Next

Eurosurveillance, Volume 21, Issue 27, 07 July 2016
Rapid communication
Xavier, Lammens, Ruhal, Kumar-Singh, Butaye, Goossens, and Malhotra-Kumar: Identification of a novel plasmid-mediated colistin-resistance gene, mcr-2, in Escherichia coli, Belgium, June 2016

+ Author affiliations


Citation style for this article: Xavier BB, Lammens C, Ruhal R, Kumar-Singh S, Butaye P, Goossens H, Malhotra-Kumar S. Identification of a novel plasmid-mediated colistin-resistance gene, mcr-2, in Escherichia coli, Belgium, June 2016. Euro Surveill. 2016;21(27):pii=30280. DOI: http://dx.doi.org/10.2807/1560-7917.ES.2016.21.27.30280

Received:27 June 2016; Accepted:07 July 2016


Following the report of of mcr-1 detection in China in November 2015 [1], we screened 105 colistin-resistant Escherichia coli (colistin minimum inhibitory concentration (MIC) 4–8 mg/L [2]) isolated during 2011–12 from passive surveillance of diarrhoea in 52 calves and 53 piglets in Belgium [3]. mcr-1 was detected in 12.4% (n = 13) of the E. coli isolates, of which six and seven were from calves and piglets, respectively [3,4]. In the present study, we analysed porcine and bovine colistin-resistant Escherichia coli isolates that did not show presence of mcr-1 and identified a novel plasmid-mediated colistin resistance-conferring gene, mcr-2.

Identification of mcr-2 in colistin-resistant E. coli isolates not harbouring mcr-1

Of 92 porcine and bovine colistin-resistant Escherichia coli isolates not harbouring mcr-1, 10 were randomly selected for further analysis. Plasmid DNA was isolated (PureLink HiPure Plasmid Miniprep Kit, Invitrogen, Carlsbad, CA, United States), sequenced by Illumina (2 x 250 bp) (Nextera XT sample preparation kit, MiSeq), de novo assembled and annotated using SPAdes (v3.8.1) and RAST [5,6]. Plasmids from three of the 10 E. coli isolates showed the presence of a gene for a putative membrane protein, which was identified as a phosphoethanolamine transferase (sulfatase) using pfam and Interproscan protein databases [7,8] The mcr-2 gene, as we termed it, is 1,617 bp long, nine bases shorter than mcr-1 (1,626 bp), and shows 76.75% nt identity to mcr-1 (supplementary material [9]).

The entire mcr-2 gene was amplified (PCR primers: MCR2-F 5′ TGGTACAGCCCCTTTATT 3′; MCR2-R 5′ GCTTGAGATTGGGTTATGA 3′), cloned (vector pCR 2.1, TOPO TA Cloning kit, Invitrogen) and electroporated into DH-5 α E. coli. Transformants exhibited colistin MICs of 4–8 mg/L (E-test, bioMerieux, Marcy l’Etoile, France), which were reconfirmed by macrobroth dilution (European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines [2]).

mcr-2 is harboured on IS1595 with likely origins in Moraxella spp.

mcr-2-harbouring plasmids from all three E. coli isolates were analysed. The mobile element harbouring mcr-2 was identified as an IS element of the IS1595 superfamily, which are distinguished by the presence of an ISXO2-like transposase domain [10].

We also identified a 297 bp open reading frame downstream of mcr-2 on this element, which encodes a PAP2 membrane-associated lipid phosphatase with 41% identity to Moraxella osloensis phosphatidic acid phosphatase (71% query coverage). Interestingly, a blastn search of the IS1595 backbone, after removal of the mcr-2 and pap2 phosphatase gene sequences, identified a single hit to Moraxella bovoculi strain 58069 (GenBank accession number CP011374) genomic region (1,531,602 to 1,532,255 bp) with 75% identity and 100% query coverage.

mcr-2 is harboured on an IncX4 incompatibility-type plasmid in E. coli ST10

The three mcr-2 plasmid-harbouring E. coli isolates belonged to ST10 (n = 2, porcine) and ST167 (n = 1, bovine). All three plasmids belonged to IncX4 incompatibility type; all three mcr-2 genes showed 100% homology.

Plasmid pKP37-BE isolated from one of the porcine ST10 E. coli isolates was found to have a size of 35,104 bp, 41.3% GC content and 56 protein-encoding gene sequences (RAST) (Figure 1); European Nucleotide Archive accession numbers PRJEB14596 (study) and LT598652 (plasmid sequence).

Figure 1

Genetic organisation and structure of the mcr-2-harbouring plasmid pKP37-BE from a colistin-resistant Escherichia coli isolate not harbouring mcr-1, Belgium, June 2016

/images/dynamic/articles/22525/16-00435-f1

The plasmid map was generated using GenomeVx [28].

Apart from IS1595, pKP37-BE did not carry any other resistance genes and the plasmid backbone was highly similar to Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH146_32 (GenBank accession number JX258655), with 98% identity and 90% query coverage. Several Salmonella-associated virulence genes were found on pKP37-BE, including virB/D4 that encodes a type 4 secretion system [11].

Conjugation experiments using a rifampicin-resistant E. coli recipient (A15) showed an approximately 1,200-fold higher transfer frequency of the mcr-2-harbouring pKP37-BE (1.71 × 10−3) compared with the mcr-1 harbouring IncFII plasmid, pKP81-BE (1.39 × 10−6) [4]. Both mcr-1 and mcr-2 transconjugants exhibited colistin MICs of 4–8 mg/L (macrobroth dilution).

Structure predictions and phylogenetic analyses of the MCR-2 protein

MCR-2 protein was predicted to have two domains, with domain 1 (1 to 229 residues) as a transporter and domain 2 (230 to 538 residues) as a transferase domain (Figure 2).

Figure 2

MCR-2 and MCR-1 predicted tertiary structures

/images/dynamic/articles/22525/16-00435-f2

RaptorX [29] was used to generate the structures. For both MCR-2 and MCR-1, domain 1 was predicted to be a transporter and domain 2 a phosphoethanolamine transferase (sulfatase).

The best template for domain 1 was 4HE8, a secondary membrane transport protein with a role in transferring solutes across membranes [12]. The best-fit template for domain 2 was 4kav (p = 4.13 e-13), a lipooligosaccharide phosphoethanolamine transferase A from Neisseria meningitides, also previously shown to be the best-fit template for MCR-1 [1]. 4kav belongs to the YhjW/YjdB/YijP superfamily and its role in conferring polymyxin resistance has been experimentally validated [13]. Overall, the un-normalised global distance test (uGDT) was 318 (GDT: 58) and all 538 residues were modelled (Figure 2).

MCR-1 and MCR-2 proteins showed 80.65% identity (supplementary material [9]). In addition, MCR-2 showed 64% identity to the phosphoethanolamine transferase of Moraxella osloensis (WP_062333180) with 99% sequence coverage, and 65%, 65%, and 61% identity to that of Enhydrobacter aerosaccus (KND21726), Paenibacillus sophorae (WP_063619495) and Moraxella catarrhalis (WP_003672704), respectively, all with 97% query coverage.

We also carried out blastp searches of the two domains of MCR-2 separately. The identity level of domain 1 between MCR-1 and MCR-2 was low (72%) compared with that for domain 2 (87.4%). Other blastp hits for the domain 2 transferase were Enhydrobacter aerosaccus and Moraxella osloensis (69% identity; 100% query coverage) followed by Paenibacillus sophorae (68% identity; 100% query coverage) and Moraxella catarrhalis (68% identity; 99% query coverage). Phylogenetic analysis showed that MCR-2 might have originated from Moraxella catarrhalis (56% bootstrap value) (Figure 3).

Figure 3

Phylogenetic analysis of the entire MCR-2 protein sequence

/images/dynamic/articles/22525/16-00435-f3

Maximum likelihood tree generated by bootstrap analysis using 1,000 replicates. The analysis was carried out using CLC Genomics workbench v9.0.1 (clcbio, Qiagen) in-built tool for this evolutionary relationship with other related sequences. Branch length is proportional to the number of substitutions per site. Bootstrap values are indicated in the nodes.

PCR-based screening identified a higher prevalence of mcr-2 than of mcr-1 in porcine E. coli in Belgium

We screened our entire collection of porcine and bovine colistin-resistant E. coli isolates (n = 105) using an mcr-2-specific PCR approach using primers MCR2-IF 5’ TGTTGCTTGTGCCGATTGGA 3’ and MCR2-IR 5’ AGATGGTATTGTTGGTTGCTG 3’, and the following cycling conditions: 33 cycles of 95 °C × 3 min, 65 °C × 30 s, 72 °C × 1 min, followed by 1 cycle of 72 °C × 10 min. We found mcr-2 in 11/53 porcine and 1/52 bovine colistin-resistant E. coli isolates (an overall prevalence of 11.4%).

Discussion

Identification of plasmid-mediated colistin resistance represents a paradigm shift in colistin-resistance mechanisms, which until recently were restricted to chromosomal mutations and vertical transmission. Since mcr-1 conferring plasmid-mediated colistin resistance was first detected in China, mcr-1 has been identified in 32 countries across five continents [14-22] (Figure 4)*.

Figure 4

Countries (n = 32)* reporting presence of mcr-1 in samples of animal, environmental or human origin (data collected till 27 June 2016)

/images/dynamic/articles/22525/16-00435-f4

Adapted from [15]; updated using data from [14,16-22]*.

Our analysis identified a novel plasmid-mediated phosphoethanolamine transferase-encoding gene, mcr-2, which was detected at an even higher prevalence than that of mcr-1 among colistin-resistant porcine E. coli in our study. We were, however, limited by small sample numbers. It should also be noted that the calves and piglets were from different regions of the country (calves from Wallonia and piglets from Flanders).

Phylogenetic analysis of MCR-2 provided strong evidence that this protein was distinct from MCR-1, and that it might have originated from Moraxella catarrhalis. The latter set of data are further strengthened by the fact that mcr-2 is co-harboured with a lipid phosphatase gene that shows highest homology to a phosphatase from Moraxella spp., and that the genetic element IS1595 harbouring these two genes might itself have originated from Moraxella spp. While Moraxella spp. are not polymyxin producers, this bacterial genus is known to be intrinsically resistant to polymyxins [23] and potential intergeneric transfer of mcr-2 from co-habiting Moraxella spp. of animal, human or environmental origin is therefore highly likely. Phosphoethanolamine transferases are housekeeping enzymes that catalyse the addition of the phosphoethanolamine moiety to the outer 3-deoxy-D-manno-octulosonic acid (Kdo) residue of a Kdo(2)-lipid A [24]. The fact that we did not identify any chromosomal mutations in the known colistin resistance-conferring genes in our E. coli isolates (by whole genome sequencing, data not shown) additionally supports the role of the acquired phosphoethanolamine transferase in conferring colistin resistance.

Finally, the high transfer frequency of the mcr-2-harbouring IncX4 plasmid might underlie the higher prevalence of mcr-2 in our porcine isolates. In the three mcr-2 harbouring isolates analysed, IS1595 showed presence of direct repeats and a complete tnpA gene, while inverted repeats were not found (data not shown). However, the carrier plasmid IncX4 is itself highly transmissible, showing 102–105-fold higher transfer frequencies than, for instance, epidemic IncFII plasmids, as shown previously [25] as well as in our own transconjugation experiments. Importantly, a lack of fitness-burden of IncX4 carriage on bacterial hosts [25] makes this plasmid replicon a highly effective vehicle for dissemination of mcr-2. IncX4 plasmids have also been previously shown to harbour mcr-1 [26] as well as extended spectrum beta-lactamase genes, blaCTX-M [25]. Interestingly, the pKP37-BE backbone, which likely originated from Salmonella spp., harboured a battery of virulence genes including the virB4/D4 genes encoding a type-IV secretion system that has been shown to mediate downregulation of host innate immune response genes and an increased bacterial uptake and survival within macrophages and epithelial cells [11]. Outer membrane modifications leading to colistin resistance have been shown to attenuate virulence [27]: whether these co-harboured virulence genes are able to compensate the pathogenic abilities of colistin-resistant E. coli remains to be explored.

Taken together, these data call for immediate inclusion of mcr-2 screening in ongoing molecular epidemiological surveillance to gauge the worldwide dissemination of mcr-2 in both human and animal colistin-resistant Gram-negative bacteria of medical importance.


* Authors’ correction

The number of countries in which mcr-1 has been identified was updated to 32 and supporting references were added on 11 July 2016. The references in the article were renumbered accordingly.

Acknowledgements

This work and BBX are supported by University of Antwerp Research Funds (BOF-DOCPRO 2012-27450). The study was also supported by European Union Horizon 2020 Research and Innovation Programme: Compare (‘COllaborative Management Platform for detection and Analyses of (Re-) emerging and foodborne outbreaks in Europe: Grant No. 643476). We would like to thank Dierengezondheid Vlaanderen (DGZ) and Association Régional de Santé et d’Identification Animale (ARSIA) for strain collection.

The complete plasmid sequence of pKP37-BE was deposited at the European Nucleotide Archive accession numbers PRJEB14596 (study) and LT598652 (plasmid sequence).

Conflict of interest

None declared.

Authors’ contributions

This study was designed by SMK. Isolates were collected by PB. Experimental work was done by BBX and CL. Data was analysed and interpreted by BBX, RR, SKS, HG and SMK. The manuscript was drafted by BBX, SKS and SMK, and was reviewed by all authors.


References

  1. Liu Y-Y, Wang Y, Walsh TR, Yi L-X, Zhang R, Spencer J,  et al.  Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infect Dis. 2016;16(2):161-8. DOI: 10.1016/S1473-3099(15)00424-7 PMID: 26603172

  2. European Committee on Antimicrobial Susceptibility Testing (EUCAST). Breakpoint tables for interpretation of MICs and zone diameters. Version 6.0, 2016. EUCAST; 2016. Available from: http://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Breakpoint_tables/v_6.0_Breakpoint_table.pdf

  3. Malhotra-Kumar S, Xavier BB, Das AJ, Lammens C, Butaye P, Goossens H. Colistin resistance gene mcr-1 harboured on a multidrug resistant plasmid.Lancet Infect Dis. 2016;16(3):283-4. DOI: 10.1016/S1473-3099(16)00012-8 PMID: 26774247

  4. Xavier BB, Lammens C, Butaye P, Goossens H, Malhotra-Kumar S. Complete sequence of an IncFII plasmid harbouring the colistin resistance gene mcr-1 isolated from Belgian pig farms.J Antimicrob Chemother. 2016;dkw191. DOI: 10.1093/jac/dkw191 PMID: 27261261

  5. Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS,  et al.  SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol. 2012;19(5):455-77. DOI: 10.1089/cmb.2012.0021 PMID: 22506599

  6. Aziz RK, Bartels D, Best AA, DeJongh M, Disz T, Edwards RA,  et al.  The RAST Server: rapid annotations using subsystems technology. BMC Genomics. 2008;9(1):75. DOI: 10.1186/1471-2164-9-75 PMID: 18261238

  7. Finn RD, Coggill P, Eberhardt RY, Eddy SR, Mistry J, Mitchell AL,  et al.  The Pfam protein families database: towards a more sustainable future. Nucleic Acids Res. 2016;44(D1):D279-85. DOI: 10.1093/nar/gkv1344 PMID: 26673716

  8. Quevillon E, Silventoinen V, Pillai S, Harte N, Mulder N, Apweiler R, et al. InterProScan: protein domains identifier. Nucleic Acids Res. 20051;33(Web Server issue):W116-20. PMID:15980438

  9. Xavier BB, Lammens C, Ruhal R, Kumar-Singh S, Butaye P, Goossens H, et al. Rapid Communication, Eurosurveillance, Identification of a novel plasmid-mediated colistin-resistant gene mcr-2 in E. coli. Supplementary material. [Accessed 7 Jul 2016]. Available from: https://www.uantwerpen.be/en/rg/lab-of-medical-microbiology/projects-and-publications/publications/key-publications/rapid-communication-eurosurveillance/

  10. Siguier P, Perochon J, Lestrade L, Mahillon J, Chandler M. ISfinder: the reference centre for bacterial insertion sequences.Nucleic Acids Res. 2006;34(Database issue):D32-6. DOI: 10.1093/nar/gkj014 PMID: 16381877

  11. Gokulan K, Khare S, Rooney AW, Han J, Lynne AM, Foley SL. Impact of plasmids, including those encodingVirB4/D4 type IV secretion systems, on Salmonella enterica serovar Heidelberg virulence in macrophages and epithelial cells.PLoS One. 2013;8(10):e77866. DOI: 10.1371/journal.pone.0077866 PMID: 24098597

  12. Berrisford JM, Baradaran R, Sazanov LA. Structure of bacterial respiratory complex I.Biochim Biophys Acta. 2016;1857(7):892-901. DOI: 10.1016/j.bbabio.2016.01.012 PMID: 26807915

  13. Wanty C, Anandan A, Piek S, Walshe J, Ganguly J, Carlson RW,  et al.  The structure of the neisserial lipooligosaccharide phosphoethanolamine transferase A (LptA) required for resistance to polymyxin. J Mol Biol. 2013;425(18):3389-402. DOI: 10.1016/j.jmb.2013.06.029 PMID: 23810904

  14. Fernandes MR, Moura Q, Sartori L, Silva KC, Cunha MP, Esposito F, et al. Silent dissemination of colistin-resistant Escherichia coli in South America could contribute to the global spread of the mcr-1 gene. Euro Surveill. 2016;21(17) 16;21(17):pii=30214.

  15. Skov RL, Monnet DL. Plasmid-mediated colistin resistance (mcr-1 gene): three months later, the story unfolds.Euro Surveill. 2016;21(9):30155. DOI: 10.2807/1560-7917.ES.2016.21.9.30155 PMID: 26967914

  16. Prim N, Rivera A, Rodriguez-Navarro J, Espanol M, Turbau M, Coll P, et al. Detection of mcr-1 colistin resistance gene in polyclonal Escherichia coli isolates in Barcelona, Spain, 2012 to 2015. Euro Surveill. 2016;21(13) (13):pii=30183.

  17. Perreten V, Strauss C, Collaud A, Gerber D. Colistin Resistance Gene mcr-1 in Avian-Pathogenic Escherichia coli in South Africa.Antimicrob Agents Chemother. 2016;60(7):4414-5. DOI: 10.1128/AAC.00548-16 PMID: 27161625

  18. Rapoport M, Faccone D, Pasteran F, Ceriana P, Albornoz E, Petroni A,  et al.  First Description of mcr-1-Mediated Colistin Resistance in Human Infections Caused by Escherichia coli in Latin America. Antimicrob Agents Chemother. 2016;60(7):4412-3. DOI: 10.1128/AAC.00573-16 PMID: 27090181

  19. Izdebski R, Baraniak A, Bojarska K, Urbanowicz P, Fiett J, Pomorska-Wesołowska M, et al. Mobile MCR-1-associated resistance to colistin in Poland. J Antimicrob Chemother. 2016 Jun 20. pii: dkw261. DOI: 10.1093/jac/dkw261 PMID:27330064

  20. McGann P, Snesrud E, Maybank R, Corey B, Ong AC, Clifford R,  et al.  Escherichia coli Harboring mcr-1 and blaCTX-M on a Novel IncF Plasmid: First Report of mcr-1 in the United States. Antimicrob Agents Chemother. 2016;60(7):4420-1. DOI: 10.1128/AAC.01103-16 PMID: 27230792

  21. Arcilla MS, van Hattem JM, Matamoros S, Melles DC, Penders J, de Jong MD,  et al.  Dissemination of the mcr-1 colistin resistance gene. Lancet Infect Dis. 2016;16(2):147-9. DOI: 10.1016/S1473-3099(15)00541-1 PMID: 26711361

  22. Bernasconi OJ, Kuenzli E, Pires J, Tinguely R, Carattoli A, Hatz C, et al. Travelers Can Import Colistin-Resistant Enterobacteriaceae Including Those Possessing the Plasmid-Mediated mcr-1 Gene. Antimicrob Agents Chemother. 2016 Jun 13. pii: AAC.00731-16. PMID: 27297483

  23. Storm DR, Rosenthal KS, Swanson PE. Polymyxin and related peptide antibiotics.Annu Rev Biochem. 1977;46(1):723-63. DOI: 10.1146/annurev.bi.46.070177.003451 PMID: 197881

  24. Reynolds CM, Kalb SR, Cotter RJ, Raetz CRH. A phosphoethanolamine transferase specific for the outer 3-deoxy-D-manno-octulosonic acid residue of Escherichia coli lipopolysaccharide. Identification of the eptB gene and Ca2+ hypersensitivity of an eptB deletion mutant.J Biol Chem. 2005;280(22):21202-11. DOI: 10.1074/jbc.M500964200 PMID: 15795227

  25. Lo WU, Chow KH, Law PY, Ng KY, Cheung YY, Lai EL,  et al.  Highly conjugative IncX4 plasmids carrying blaCTX-M in Escherichia coli from humans and food animals. J Med Microbiol. 2014;63(Pt 6):835-40. DOI: 10.1099/jmm.0.074021-0 PMID: 24595536

  26. Hasman H, Hammerum AM, Hansen F, Hendriksen RS, Olesen B, Agersø Y,  et al.  Detection of mcr-1 encoding plasmid-mediated colistin-resistant Escherichia coli isolates from human bloodstream infection and imported chicken meat, Denmark 2015. Euro Surveill. 2015;20(49):30085. DOI: 10.2807/1560-7917.ES.2015.20.49.30085 PMID: 26676364

  27. Vila-Farrés X, Ferrer-Navarro M, Callarisa AE, Martí S, Espinal P, Gupta S,  et al.  Loss of LPS is involved in the virulence and resistance to colistin of colistin-resistant Acinetobacter nosocomialis mutants selected in vitro. J Antimicrob Chemother. 2015;70(11):2981-6. DOI: 10.1093/jac/dkv244 PMID: 26311838

  28. Conant G, Wolfe K. GenomeVx. Dublin: University College Dublin. [Accessed 22 Jun 2016]. Available from: http://wolfe.ucd.ie/GenomeVx/

  29. Källberg M, Margaryan G, Wang S, Ma J, Xu J. RaptorX server: a resource for template-based protein structure modeling.Methods Mol Biol. 2014;1137:17-27. DOI: 10.1007/978-1-4939-0366-5_2 PMID: 24573471



Back to Table of Contents
Previous Download (pdf)
Next

The publisher’s policy on data collection and use of cookies.

Disclaimer: The opinions expressed by authors contributing to Eurosurveillance do not necessarily reflect the opinions of the European Centre for Disease Prevention and Control (ECDC) or the editorial team or the institutions with which the authors are affiliated. Neither ECDC nor any person acting on behalf of ECDC is responsible for the use that might be made of the information in this journal. The information provided on the Eurosurveillance site is designed to support, not replace, the relationship that exists between a patient/site visitor and his/her physician. Our website does not host any form of commercial advertisement. Except where otherwise stated, all manuscripts published after 1 January 2016 will be published under the Creative Commons Attribution (CC BY) licence. You are free to share and adapt the material, but you must give appropriate credit, provide a link to the licence, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.

Eurosurveillance [ISSN] - ©2007-2016. All rights reserved
 

This website is certified by Health On the Net Foundation. Click to verify. This site complies with the HONcode standard for trustworthy health information:
verify here.